Recombinant:Article Title: Tumor-initiating stem cells fine-tune the plasticity of neutrophils to sculpt a protective niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER beta-mercaptoethanol GIBCO Cat# 21985023 insulin Sigma Cat# I6634 Hydrocortisone Sigma Cat# H0135 Epidermal Growth Factor (EGF), human recombinant Sigma Cat# 01-107 Recombinant Mouse GM-CSF Biolegend Cat# 576306 Recombinant Mouse IFN-α Biolegend Cat# 752802 Recombinant Mouse IFN-γ Biolegend Cat# 575302 RNAscope Probe-Mm-Gbp2-C2 Advanced Cell Diagnostics Cat# 572491-C2 Recombinant Mouse IL-2 Protein R&D Systems Cat# 402-ML-100/CF OVA 323-339 Invivogen Cat# vac-isq Aspirin Cayman Chemical Cat# 70260 Celecoxib Selleckchem Cat# S1261 DMBA Sigma Cat# D3254 TPA Sigma Cat# P8139-5MG IHC Antigen Retrieval Solution - Low pH Thermo Fisher Scientific Cat# 00-4955-58 Prolong Gold Antifade Mountant Thermo Fisher Scientific Cat# P36930 Collagenase, Type IV Gibco Cat# 17104019 DNase I Roche Cat# 4536282001 Critical commercial assays GeoMx WTA Starter Mm Nanostring Cat# 999064 EvercodeTM WT v2 ParseBiosciences Cat# ECW02030 EvercodeTM Cell Fixation v2 ParseBiosciences Cat# ECF2001 UDI Plate - WT ParseBiosciences Cat# UDI1001 NEBNext Single Cell/Low input RNA library prep kit for Illumina New England Biolabs Cat# E6420S MojoSort Mouse Ly-6G Selection Kit Biolegend Cat# 480124 MojoSort Mouse CD4 NaiveT Cell Isolation Kit Biolegend Cat# 480040 RNAscope Multiplex Fluorescent Reagent Kit v2 Advanced Cell Diagnostics Cat# 323100 BD Cytofix/CytopermTM Fixation/ Permeabilization Kit BD Cat# 554714 Cell Stimulation Cocktail (plus protein transport inhibitors) Thermo Fisher Scientific Cat# 00-4975-03 NEBuilder® HiFi DNA Assembly Master Mix New England Biolabs Cat# E2621S LipofectamineTM 3000 Transfection Reagent Thermo Fisher Scientific Cat# L3000008 CUTANATM ChIC/CUT&RUN Kit version 3 EpiCypher Cat# 14-1048 NEBNext® UltraTM II DNA Library Prep Kit for Illumina New England Biolabs Cat# E7645S Deposited data scRNAseq of CD45+ cells in skin SCC This study GEO: GSE278435 NanoString GeoMx of skin SCC This study GEO: GSE278436 Bulk RNAseq data of neutrophils in skin SCC This study GEO: GSE278430 Bulk RNAseq data or SOX2Low and SOX2High SCC cells This study GEO: GSE278429 SOX2 Cut and Run sequencing This study GEO: GSE278426 Bulk RNAseq data or ITGA6HiCD80+ and ITGA6LowCD80- SCC cells This study GEO: GSE303056 Spatial transcriptome of human HNSCC Arora et al.55 GEO: GSE208253 Spatial transcriptome of human CSCC Ji et al.56 GEO: GSE144239 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–18.e1–e11, January 12, 2026 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNAseq of neutrophils in grafted pancreatic cancer Ng et al.24 GEO: GSE243466 scRNAseq of CD11b+ cells in grafted lung cancer Gungabeesoon et al.31 GEO: GSE224399 scRNAseq of CD45+ cells in grafted colon cancer Gungabeesoon et al.31 GEO: GSE224400 scRNAseq of immune cells from lung cancer patients treated with immune checkpoint blockade Liu et al.54 GEO: GSE243013 Experimental models: cell lines Mouse skin SCC PDVC57 Bremner et al.68 N/A Mouse oral SCC MOC1 Kerafast EWL001-FP Mouse skin SCC PDV Bremner et al.68 N/A Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory 000664 Mouse: C57BL/6N-Ifngr1tm1.1Rds/J (Ifngr1flox/flox) The Jackson Laboratory 025394 Mouse: C57BL/6Ly6g(tm2621(CretdTomato)Arte); R26-LSL-tdTomato (CatchupIVM-red) Hasenberg et al.46 N/A Mouse: C57BL/6-Ly6G-CreER; R26-LSL-tdTomato Ballesteros et al.45 N/A Mouse: B6.Cg-Tg(S100A8-cre,-EGFP)1Ilw/J The Jackson Laboratory 021614 Mouse: C57BL/6-Gt(ROSA)26Sortm1(HBEGF)Awai/J (R26-LSL-DTR) The Jackson Laboratory 007900 Mouse: B6.Tg(KRT14-cre/ERT)20Efu/J (K14CreER) The Jackson Laboratory 005107 Mouse: B6.Sox2tm1.1Lan/J (Sox2flox/flox) The Jackson Laboratory 013093 Mouse: B6(Cg)-Ifnar1tm1.1Ees/J (Ifnar1flox/flox) The Jackson Laboratory 028256 Mouse: Lyz2Cre; Ptger2flox/flox; Ptger4flox/flox (Ptger2/Ptger4 dKO) Thumkeo et al.62 N/A Oligonucleotides sgSox2_F: CACCGATAAGTACACGCTTCCCGG This study N/A sgSox2_R: AAACCCGGGAAGCGTGTACTTATC This study N/A sgFads1_F: CACCGAGGCCCATTCGCTCTACTG This study N/A sgFads1_R: AAACCAGTAGAGCGAATGGGCCTC This study N/A H2-Aa qPCR forward: GGAGGTGAAGACGACATTGAGG This study N/A H2-Aa qPCR reverse: CTCAGGAAGCATCCAGACAGTC This study N/A Gbp2 qPCR forward: CTGCAC TATGTGACGGAGCTA This study N/A Gbp2 qPCR reverse: GAGTCCACACAAAGGTTGGAAA This study N/A 18S rRNA qPCR forward: CTTAGAGGGACAAGTGGCG This study N/A 18S rRNA qPCR reverse: ACGCTGAGCCAGTCAGTGTA This study N/A Ifit3 qPCR forward: GTGGACTGAGATTTCTGAACTGC This study N/A Ifit3 qPCR reverse: GCTTCCAGAGATTCCCGGTT This study N/A Cd74 qPCR forward: CTCCATGGATGGCGTGAACT This study N/A Cd74 qPCR reverse: GTGGCTCTTTAGGTGGAGCC This study N/A (Continued on next page) ll OPEN ACCESS Article e4 Cancer Cell 44, 1–18.e1–e11, January 12, 2026
RNAscope:Article Title: Tumor-initiating stem cells fine-tune the plasticity of neutrophils to sculpt a protective niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER beta-mercaptoethanol GIBCO Cat# 21985023 insulin Sigma Cat# I6634 Hydrocortisone Sigma Cat# H0135 Epidermal Growth Factor (EGF), human recombinant Sigma Cat# 01-107 Recombinant Mouse GM-CSF Biolegend Cat# 576306 Recombinant Mouse IFN-α Biolegend Cat# 752802 Recombinant Mouse IFN-γ Biolegend Cat# 575302 RNAscope Probe-Mm-Gbp2-C2 Advanced Cell Diagnostics Cat# 572491-C2 Recombinant Mouse IL-2 Protein R&D Systems Cat# 402-ML-100/CF OVA 323-339 Invivogen Cat# vac-isq Aspirin Cayman Chemical Cat# 70260 Celecoxib Selleckchem Cat# S1261 DMBA Sigma Cat# D3254 TPA Sigma Cat# P8139-5MG IHC Antigen Retrieval Solution - Low pH Thermo Fisher Scientific Cat# 00-4955-58 Prolong Gold Antifade Mountant Thermo Fisher Scientific Cat# P36930 Collagenase, Type IV Gibco Cat# 17104019 DNase I Roche Cat# 4536282001 Critical commercial assays GeoMx WTA Starter Mm Nanostring Cat# 999064 EvercodeTM WT v2 ParseBiosciences Cat# ECW02030 EvercodeTM Cell Fixation v2 ParseBiosciences Cat# ECF2001 UDI Plate - WT ParseBiosciences Cat# UDI1001 NEBNext Single Cell/Low input RNA library prep kit for Illumina New England Biolabs Cat# E6420S MojoSort Mouse Ly-6G Selection Kit Biolegend Cat# 480124 MojoSort Mouse CD4 NaiveT Cell Isolation Kit Biolegend Cat# 480040 RNAscope Multiplex Fluorescent Reagent Kit v2 Advanced Cell Diagnostics Cat# 323100 BD Cytofix/CytopermTM Fixation/ Permeabilization Kit BD Cat# 554714 Cell Stimulation Cocktail (plus protein transport inhibitors) Thermo Fisher Scientific Cat# 00-4975-03 NEBuilder® HiFi DNA Assembly Master Mix New England Biolabs Cat# E2621S LipofectamineTM 3000 Transfection Reagent Thermo Fisher Scientific Cat# L3000008 CUTANATM ChIC/CUT&RUN Kit version 3 EpiCypher Cat# 14-1048 NEBNext® UltraTM II DNA Library Prep Kit for Illumina New England Biolabs Cat# E7645S Deposited data scRNAseq of CD45+ cells in skin SCC This study GEO: GSE278435 NanoString GeoMx of skin SCC This study GEO: GSE278436 Bulk RNAseq data of neutrophils in skin SCC This study GEO: GSE278430 Bulk RNAseq data or SOX2Low and SOX2High SCC cells This study GEO: GSE278429 SOX2 Cut and Run sequencing This study GEO: GSE278426 Bulk RNAseq data or ITGA6HiCD80+ and ITGA6LowCD80- SCC cells This study GEO: GSE303056 Spatial transcriptome of human HNSCC Arora et al.55 GEO: GSE208253 Spatial transcriptome of human CSCC Ji et al.56 GEO: GSE144239 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–18.e1–e11, January 12, 2026 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNAseq of neutrophils in grafted pancreatic cancer Ng et al.24 GEO: GSE243466 scRNAseq of CD11b+ cells in grafted lung cancer Gungabeesoon et al.31 GEO: GSE224399 scRNAseq of CD45+ cells in grafted colon cancer Gungabeesoon et al.31 GEO: GSE224400 scRNAseq of immune cells from lung cancer patients treated with immune checkpoint blockade Liu et al.54 GEO: GSE243013 Experimental models: cell lines Mouse skin SCC PDVC57 Bremner et al.68 N/A Mouse oral SCC MOC1 Kerafast EWL001-FP Mouse skin SCC PDV Bremner et al.68 N/A Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory 000664 Mouse: C57BL/6N-Ifngr1tm1.1Rds/J (Ifngr1flox/flox) The Jackson Laboratory 025394 Mouse: C57BL/6Ly6g(tm2621(CretdTomato)Arte); R26-LSL-tdTomato (CatchupIVM-red) Hasenberg et al.46 N/A Mouse: C57BL/6-Ly6G-CreER; R26-LSL-tdTomato Ballesteros et al.45 N/A Mouse: B6.Cg-Tg(S100A8-cre,-EGFP)1Ilw/J The Jackson Laboratory 021614 Mouse: C57BL/6-Gt(ROSA)26Sortm1(HBEGF)Awai/J (R26-LSL-DTR) The Jackson Laboratory 007900 Mouse: B6.Tg(KRT14-cre/ERT)20Efu/J (K14CreER) The Jackson Laboratory 005107 Mouse: B6.Sox2tm1.1Lan/J (Sox2flox/flox) The Jackson Laboratory 013093 Mouse: B6(Cg)-Ifnar1tm1.1Ees/J (Ifnar1flox/flox) The Jackson Laboratory 028256 Mouse: Lyz2Cre; Ptger2flox/flox; Ptger4flox/flox (Ptger2/Ptger4 dKO) Thumkeo et al.62 N/A Oligonucleotides sgSox2_F: CACCGATAAGTACACGCTTCCCGG This study N/A sgSox2_R: AAACCCGGGAAGCGTGTACTTATC This study N/A sgFads1_F: CACCGAGGCCCATTCGCTCTACTG This study N/A sgFads1_R: AAACCAGTAGAGCGAATGGGCCTC This study N/A H2-Aa qPCR forward: GGAGGTGAAGACGACATTGAGG This study N/A H2-Aa qPCR reverse: CTCAGGAAGCATCCAGACAGTC This study N/A Gbp2 qPCR forward: CTGCAC TATGTGACGGAGCTA This study N/A Gbp2 qPCR reverse: GAGTCCACACAAAGGTTGGAAA This study N/A 18S rRNA qPCR forward: CTTAGAGGGACAAGTGGCG This study N/A 18S rRNA qPCR reverse: ACGCTGAGCCAGTCAGTGTA This study N/A Ifit3 qPCR forward: GTGGACTGAGATTTCTGAACTGC This study N/A Ifit3 qPCR reverse: GCTTCCAGAGATTCCCGGTT This study N/A Cd74 qPCR forward: CTCCATGGATGGCGTGAACT This study N/A Cd74 qPCR reverse: GTGGCTCTTTAGGTGGAGCC This study N/A (Continued on next page) ll OPEN ACCESS Article e4 Cancer Cell 44, 1–18.e1–e11, January 12, 2026
Immunohistochemistry:Article Title: Tumor-initiating stem cells fine-tune the plasticity of neutrophils to sculpt a protective niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER beta-mercaptoethanol GIBCO Cat# 21985023 insulin Sigma Cat# I6634 Hydrocortisone Sigma Cat# H0135 Epidermal Growth Factor (EGF), human recombinant Sigma Cat# 01-107 Recombinant Mouse GM-CSF Biolegend Cat# 576306 Recombinant Mouse IFN-α Biolegend Cat# 752802 Recombinant Mouse IFN-γ Biolegend Cat# 575302 RNAscope Probe-Mm-Gbp2-C2 Advanced Cell Diagnostics Cat# 572491-C2 Recombinant Mouse IL-2 Protein R&D Systems Cat# 402-ML-100/CF OVA 323-339 Invivogen Cat# vac-isq Aspirin Cayman Chemical Cat# 70260 Celecoxib Selleckchem Cat# S1261 DMBA Sigma Cat# D3254 TPA Sigma Cat# P8139-5MG IHC Antigen Retrieval Solution - Low pH Thermo Fisher Scientific Cat# 00-4955-58 Prolong Gold Antifade Mountant Thermo Fisher Scientific Cat# P36930 Collagenase, Type IV Gibco Cat# 17104019 DNase I Roche Cat# 4536282001 Critical commercial assays GeoMx WTA Starter Mm Nanostring Cat# 999064 EvercodeTM WT v2 ParseBiosciences Cat# ECW02030 EvercodeTM Cell Fixation v2 ParseBiosciences Cat# ECF2001 UDI Plate - WT ParseBiosciences Cat# UDI1001 NEBNext Single Cell/Low input RNA library prep kit for Illumina New England Biolabs Cat# E6420S MojoSort Mouse Ly-6G Selection Kit Biolegend Cat# 480124 MojoSort Mouse CD4 NaiveT Cell Isolation Kit Biolegend Cat# 480040 RNAscope Multiplex Fluorescent Reagent Kit v2 Advanced Cell Diagnostics Cat# 323100 BD Cytofix/CytopermTM Fixation/ Permeabilization Kit BD Cat# 554714 Cell Stimulation Cocktail (plus protein transport inhibitors) Thermo Fisher Scientific Cat# 00-4975-03 NEBuilder® HiFi DNA Assembly Master Mix New England Biolabs Cat# E2621S LipofectamineTM 3000 Transfection Reagent Thermo Fisher Scientific Cat# L3000008 CUTANATM ChIC/CUT&RUN Kit version 3 EpiCypher Cat# 14-1048 NEBNext® UltraTM II DNA Library Prep Kit for Illumina New England Biolabs Cat# E7645S Deposited data scRNAseq of CD45+ cells in skin SCC This study GEO: GSE278435 NanoString GeoMx of skin SCC This study GEO: GSE278436 Bulk RNAseq data of neutrophils in skin SCC This study GEO: GSE278430 Bulk RNAseq data or SOX2Low and SOX2High SCC cells This study GEO: GSE278429 SOX2 Cut and Run sequencing This study GEO: GSE278426 Bulk RNAseq data or ITGA6HiCD80+ and ITGA6LowCD80- SCC cells This study GEO: GSE303056 Spatial transcriptome of human HNSCC Arora et al.55 GEO: GSE208253 Spatial transcriptome of human CSCC Ji et al.56 GEO: GSE144239 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–18.e1–e11, January 12, 2026 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNAseq of neutrophils in grafted pancreatic cancer Ng et al.24 GEO: GSE243466 scRNAseq of CD11b+ cells in grafted lung cancer Gungabeesoon et al.31 GEO: GSE224399 scRNAseq of CD45+ cells in grafted colon cancer Gungabeesoon et al.31 GEO: GSE224400 scRNAseq of immune cells from lung cancer patients treated with immune checkpoint blockade Liu et al.54 GEO: GSE243013 Experimental models: cell lines Mouse skin SCC PDVC57 Bremner et al.68 N/A Mouse oral SCC MOC1 Kerafast EWL001-FP Mouse skin SCC PDV Bremner et al.68 N/A Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory 000664 Mouse: C57BL/6N-Ifngr1tm1.1Rds/J (Ifngr1flox/flox) The Jackson Laboratory 025394 Mouse: C57BL/6Ly6g(tm2621(CretdTomato)Arte); R26-LSL-tdTomato (CatchupIVM-red) Hasenberg et al.46 N/A Mouse: C57BL/6-Ly6G-CreER; R26-LSL-tdTomato Ballesteros et al.45 N/A Mouse: B6.Cg-Tg(S100A8-cre,-EGFP)1Ilw/J The Jackson Laboratory 021614 Mouse: C57BL/6-Gt(ROSA)26Sortm1(HBEGF)Awai/J (R26-LSL-DTR) The Jackson Laboratory 007900 Mouse: B6.Tg(KRT14-cre/ERT)20Efu/J (K14CreER) The Jackson Laboratory 005107 Mouse: B6.Sox2tm1.1Lan/J (Sox2flox/flox) The Jackson Laboratory 013093 Mouse: B6(Cg)-Ifnar1tm1.1Ees/J (Ifnar1flox/flox) The Jackson Laboratory 028256 Mouse: Lyz2Cre; Ptger2flox/flox; Ptger4flox/flox (Ptger2/Ptger4 dKO) Thumkeo et al.62 N/A Oligonucleotides sgSox2_F: CACCGATAAGTACACGCTTCCCGG This study N/A sgSox2_R: AAACCCGGGAAGCGTGTACTTATC This study N/A sgFads1_F: CACCGAGGCCCATTCGCTCTACTG This study N/A sgFads1_R: AAACCAGTAGAGCGAATGGGCCTC This study N/A H2-Aa qPCR forward: GGAGGTGAAGACGACATTGAGG This study N/A H2-Aa qPCR reverse: CTCAGGAAGCATCCAGACAGTC This study N/A Gbp2 qPCR forward: CTGCAC TATGTGACGGAGCTA This study N/A Gbp2 qPCR reverse: GAGTCCACACAAAGGTTGGAAA This study N/A 18S rRNA qPCR forward: CTTAGAGGGACAAGTGGCG This study N/A 18S rRNA qPCR reverse: ACGCTGAGCCAGTCAGTGTA This study N/A Ifit3 qPCR forward: GTGGACTGAGATTTCTGAACTGC This study N/A Ifit3 qPCR reverse: GCTTCCAGAGATTCCCGGTT This study N/A Cd74 qPCR forward: CTCCATGGATGGCGTGAACT This study N/A Cd74 qPCR reverse: GTGGCTCTTTAGGTGGAGCC This study N/A (Continued on next page) ll OPEN ACCESS Article e4 Cancer Cell 44, 1–18.e1–e11, January 12, 2026
Selection:Article Title: Tumor-initiating stem cells fine-tune the plasticity of neutrophils to sculpt a protective niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER beta-mercaptoethanol GIBCO Cat# 21985023 insulin Sigma Cat# I6634 Hydrocortisone Sigma Cat# H0135 Epidermal Growth Factor (EGF), human recombinant Sigma Cat# 01-107 Recombinant Mouse GM-CSF Biolegend Cat# 576306 Recombinant Mouse IFN-α Biolegend Cat# 752802 Recombinant Mouse IFN-γ Biolegend Cat# 575302 RNAscope Probe-Mm-Gbp2-C2 Advanced Cell Diagnostics Cat# 572491-C2 Recombinant Mouse IL-2 Protein R&D Systems Cat# 402-ML-100/CF OVA 323-339 Invivogen Cat# vac-isq Aspirin Cayman Chemical Cat# 70260 Celecoxib Selleckchem Cat# S1261 DMBA Sigma Cat# D3254 TPA Sigma Cat# P8139-5MG IHC Antigen Retrieval Solution - Low pH Thermo Fisher Scientific Cat# 00-4955-58 Prolong Gold Antifade Mountant Thermo Fisher Scientific Cat# P36930 Collagenase, Type IV Gibco Cat# 17104019 DNase I Roche Cat# 4536282001 Critical commercial assays GeoMx WTA Starter Mm Nanostring Cat# 999064 EvercodeTM WT v2 ParseBiosciences Cat# ECW02030 EvercodeTM Cell Fixation v2 ParseBiosciences Cat# ECF2001 UDI Plate - WT ParseBiosciences Cat# UDI1001 NEBNext Single Cell/Low input RNA library prep kit for Illumina New England Biolabs Cat# E6420S MojoSort Mouse Ly-6G Selection Kit Biolegend Cat# 480124 MojoSort Mouse CD4 NaiveT Cell Isolation Kit Biolegend Cat# 480040 RNAscope Multiplex Fluorescent Reagent Kit v2 Advanced Cell Diagnostics Cat# 323100 BD Cytofix/CytopermTM Fixation/ Permeabilization Kit BD Cat# 554714 Cell Stimulation Cocktail (plus protein transport inhibitors) Thermo Fisher Scientific Cat# 00-4975-03 NEBuilder® HiFi DNA Assembly Master Mix New England Biolabs Cat# E2621S LipofectamineTM 3000 Transfection Reagent Thermo Fisher Scientific Cat# L3000008 CUTANATM ChIC/CUT&RUN Kit version 3 EpiCypher Cat# 14-1048 NEBNext® UltraTM II DNA Library Prep Kit for Illumina New England Biolabs Cat# E7645S Deposited data scRNAseq of CD45+ cells in skin SCC This study GEO: GSE278435 NanoString GeoMx of skin SCC This study GEO: GSE278436 Bulk RNAseq data of neutrophils in skin SCC This study GEO: GSE278430 Bulk RNAseq data or SOX2Low and SOX2High SCC cells This study GEO: GSE278429 SOX2 Cut and Run sequencing This study GEO: GSE278426 Bulk RNAseq data or ITGA6HiCD80+ and ITGA6LowCD80- SCC cells This study GEO: GSE303056 Spatial transcriptome of human HNSCC Arora et al.55 GEO: GSE208253 Spatial transcriptome of human CSCC Ji et al.56 GEO: GSE144239 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–18.e1–e11, January 12, 2026 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNAseq of neutrophils in grafted pancreatic cancer Ng et al.24 GEO: GSE243466 scRNAseq of CD11b+ cells in grafted lung cancer Gungabeesoon et al.31 GEO: GSE224399 scRNAseq of CD45+ cells in grafted colon cancer Gungabeesoon et al.31 GEO: GSE224400 scRNAseq of immune cells from lung cancer patients treated with immune checkpoint blockade Liu et al.54 GEO: GSE243013 Experimental models: cell lines Mouse skin SCC PDVC57 Bremner et al.68 N/A Mouse oral SCC MOC1 Kerafast EWL001-FP Mouse skin SCC PDV Bremner et al.68 N/A Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory 000664 Mouse: C57BL/6N-Ifngr1tm1.1Rds/J (Ifngr1flox/flox) The Jackson Laboratory 025394 Mouse: C57BL/6Ly6g(tm2621(CretdTomato)Arte); R26-LSL-tdTomato (CatchupIVM-red) Hasenberg et al.46 N/A Mouse: C57BL/6-Ly6G-CreER; R26-LSL-tdTomato Ballesteros et al.45 N/A Mouse: B6.Cg-Tg(S100A8-cre,-EGFP)1Ilw/J The Jackson Laboratory 021614 Mouse: C57BL/6-Gt(ROSA)26Sortm1(HBEGF)Awai/J (R26-LSL-DTR) The Jackson Laboratory 007900 Mouse: B6.Tg(KRT14-cre/ERT)20Efu/J (K14CreER) The Jackson Laboratory 005107 Mouse: B6.Sox2tm1.1Lan/J (Sox2flox/flox) The Jackson Laboratory 013093 Mouse: B6(Cg)-Ifnar1tm1.1Ees/J (Ifnar1flox/flox) The Jackson Laboratory 028256 Mouse: Lyz2Cre; Ptger2flox/flox; Ptger4flox/flox (Ptger2/Ptger4 dKO) Thumkeo et al.62 N/A Oligonucleotides sgSox2_F: CACCGATAAGTACACGCTTCCCGG This study N/A sgSox2_R: AAACCCGGGAAGCGTGTACTTATC This study N/A sgFads1_F: CACCGAGGCCCATTCGCTCTACTG This study N/A sgFads1_R: AAACCAGTAGAGCGAATGGGCCTC This study N/A H2-Aa qPCR forward: GGAGGTGAAGACGACATTGAGG This study N/A H2-Aa qPCR reverse: CTCAGGAAGCATCCAGACAGTC This study N/A Gbp2 qPCR forward: CTGCAC TATGTGACGGAGCTA This study N/A Gbp2 qPCR reverse: GAGTCCACACAAAGGTTGGAAA This study N/A 18S rRNA qPCR forward: CTTAGAGGGACAAGTGGCG This study N/A 18S rRNA qPCR reverse: ACGCTGAGCCAGTCAGTGTA This study N/A Ifit3 qPCR forward: GTGGACTGAGATTTCTGAACTGC This study N/A Ifit3 qPCR reverse: GCTTCCAGAGATTCCCGGTT This study N/A Cd74 qPCR forward: CTCCATGGATGGCGTGAACT This study N/A Cd74 qPCR reverse: GTGGCTCTTTAGGTGGAGCC This study N/A (Continued on next page) ll OPEN ACCESS Article e4 Cancer Cell 44, 1–18.e1–e11, January 12, 2026
Cell Isolation:Article Title: Tumor-initiating stem cells fine-tune the plasticity of neutrophils to sculpt a protective niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER beta-mercaptoethanol GIBCO Cat# 21985023 insulin Sigma Cat# I6634 Hydrocortisone Sigma Cat# H0135 Epidermal Growth Factor (EGF), human recombinant Sigma Cat# 01-107 Recombinant Mouse GM-CSF Biolegend Cat# 576306 Recombinant Mouse IFN-α Biolegend Cat# 752802 Recombinant Mouse IFN-γ Biolegend Cat# 575302 RNAscope Probe-Mm-Gbp2-C2 Advanced Cell Diagnostics Cat# 572491-C2 Recombinant Mouse IL-2 Protein R&D Systems Cat# 402-ML-100/CF OVA 323-339 Invivogen Cat# vac-isq Aspirin Cayman Chemical Cat# 70260 Celecoxib Selleckchem Cat# S1261 DMBA Sigma Cat# D3254 TPA Sigma Cat# P8139-5MG IHC Antigen Retrieval Solution - Low pH Thermo Fisher Scientific Cat# 00-4955-58 Prolong Gold Antifade Mountant Thermo Fisher Scientific Cat# P36930 Collagenase, Type IV Gibco Cat# 17104019 DNase I Roche Cat# 4536282001 Critical commercial assays GeoMx WTA Starter Mm Nanostring Cat# 999064 EvercodeTM WT v2 ParseBiosciences Cat# ECW02030 EvercodeTM Cell Fixation v2 ParseBiosciences Cat# ECF2001 UDI Plate - WT ParseBiosciences Cat# UDI1001 NEBNext Single Cell/Low input RNA library prep kit for Illumina New England Biolabs Cat# E6420S MojoSort Mouse Ly-6G Selection Kit Biolegend Cat# 480124 MojoSort Mouse CD4 NaiveT Cell Isolation Kit Biolegend Cat# 480040 RNAscope Multiplex Fluorescent Reagent Kit v2 Advanced Cell Diagnostics Cat# 323100 BD Cytofix/CytopermTM Fixation/ Permeabilization Kit BD Cat# 554714 Cell Stimulation Cocktail (plus protein transport inhibitors) Thermo Fisher Scientific Cat# 00-4975-03 NEBuilder® HiFi DNA Assembly Master Mix New England Biolabs Cat# E2621S LipofectamineTM 3000 Transfection Reagent Thermo Fisher Scientific Cat# L3000008 CUTANATM ChIC/CUT&RUN Kit version 3 EpiCypher Cat# 14-1048 NEBNext® UltraTM II DNA Library Prep Kit for Illumina New England Biolabs Cat# E7645S Deposited data scRNAseq of CD45+ cells in skin SCC This study GEO: GSE278435 NanoString GeoMx of skin SCC This study GEO: GSE278436 Bulk RNAseq data of neutrophils in skin SCC This study GEO: GSE278430 Bulk RNAseq data or SOX2Low and SOX2High SCC cells This study GEO: GSE278429 SOX2 Cut and Run sequencing This study GEO: GSE278426 Bulk RNAseq data or ITGA6HiCD80+ and ITGA6LowCD80- SCC cells This study GEO: GSE303056 Spatial transcriptome of human HNSCC Arora et al.55 GEO: GSE208253 Spatial transcriptome of human CSCC Ji et al.56 GEO: GSE144239 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–18.e1–e11, January 12, 2026 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNAseq of neutrophils in grafted pancreatic cancer Ng et al.24 GEO: GSE243466 scRNAseq of CD11b+ cells in grafted lung cancer Gungabeesoon et al.31 GEO: GSE224399 scRNAseq of CD45+ cells in grafted colon cancer Gungabeesoon et al.31 GEO: GSE224400 scRNAseq of immune cells from lung cancer patients treated with immune checkpoint blockade Liu et al.54 GEO: GSE243013 Experimental models: cell lines Mouse skin SCC PDVC57 Bremner et al.68 N/A Mouse oral SCC MOC1 Kerafast EWL001-FP Mouse skin SCC PDV Bremner et al.68 N/A Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory 000664 Mouse: C57BL/6N-Ifngr1tm1.1Rds/J (Ifngr1flox/flox) The Jackson Laboratory 025394 Mouse: C57BL/6Ly6g(tm2621(CretdTomato)Arte); R26-LSL-tdTomato (CatchupIVM-red) Hasenberg et al.46 N/A Mouse: C57BL/6-Ly6G-CreER; R26-LSL-tdTomato Ballesteros et al.45 N/A Mouse: B6.Cg-Tg(S100A8-cre,-EGFP)1Ilw/J The Jackson Laboratory 021614 Mouse: C57BL/6-Gt(ROSA)26Sortm1(HBEGF)Awai/J (R26-LSL-DTR) The Jackson Laboratory 007900 Mouse: B6.Tg(KRT14-cre/ERT)20Efu/J (K14CreER) The Jackson Laboratory 005107 Mouse: B6.Sox2tm1.1Lan/J (Sox2flox/flox) The Jackson Laboratory 013093 Mouse: B6(Cg)-Ifnar1tm1.1Ees/J (Ifnar1flox/flox) The Jackson Laboratory 028256 Mouse: Lyz2Cre; Ptger2flox/flox; Ptger4flox/flox (Ptger2/Ptger4 dKO) Thumkeo et al.62 N/A Oligonucleotides sgSox2_F: CACCGATAAGTACACGCTTCCCGG This study N/A sgSox2_R: AAACCCGGGAAGCGTGTACTTATC This study N/A sgFads1_F: CACCGAGGCCCATTCGCTCTACTG This study N/A sgFads1_R: AAACCAGTAGAGCGAATGGGCCTC This study N/A H2-Aa qPCR forward: GGAGGTGAAGACGACATTGAGG This study N/A H2-Aa qPCR reverse: CTCAGGAAGCATCCAGACAGTC This study N/A Gbp2 qPCR forward: CTGCAC TATGTGACGGAGCTA This study N/A Gbp2 qPCR reverse: GAGTCCACACAAAGGTTGGAAA This study N/A 18S rRNA qPCR forward: CTTAGAGGGACAAGTGGCG This study N/A 18S rRNA qPCR reverse: ACGCTGAGCCAGTCAGTGTA This study N/A Ifit3 qPCR forward: GTGGACTGAGATTTCTGAACTGC This study N/A Ifit3 qPCR reverse: GCTTCCAGAGATTCCCGGTT This study N/A Cd74 qPCR forward: CTCCATGGATGGCGTGAACT This study N/A Cd74 qPCR reverse: GTGGCTCTTTAGGTGGAGCC This study N/A (Continued on next page) ll OPEN ACCESS Article e4 Cancer Cell 44, 1–18.e1–e11, January 12, 2026
Multiplex Assay:Article Title: Tumor-initiating stem cells fine-tune the plasticity of neutrophils to sculpt a protective niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER beta-mercaptoethanol GIBCO Cat# 21985023 insulin Sigma Cat# I6634 Hydrocortisone Sigma Cat# H0135 Epidermal Growth Factor (EGF), human recombinant Sigma Cat# 01-107 Recombinant Mouse GM-CSF Biolegend Cat# 576306 Recombinant Mouse IFN-α Biolegend Cat# 752802 Recombinant Mouse IFN-γ Biolegend Cat# 575302 RNAscope Probe-Mm-Gbp2-C2 Advanced Cell Diagnostics Cat# 572491-C2 Recombinant Mouse IL-2 Protein R&D Systems Cat# 402-ML-100/CF OVA 323-339 Invivogen Cat# vac-isq Aspirin Cayman Chemical Cat# 70260 Celecoxib Selleckchem Cat# S1261 DMBA Sigma Cat# D3254 TPA Sigma Cat# P8139-5MG IHC Antigen Retrieval Solution - Low pH Thermo Fisher Scientific Cat# 00-4955-58 Prolong Gold Antifade Mountant Thermo Fisher Scientific Cat# P36930 Collagenase, Type IV Gibco Cat# 17104019 DNase I Roche Cat# 4536282001 Critical commercial assays GeoMx WTA Starter Mm Nanostring Cat# 999064 EvercodeTM WT v2 ParseBiosciences Cat# ECW02030 EvercodeTM Cell Fixation v2 ParseBiosciences Cat# ECF2001 UDI Plate - WT ParseBiosciences Cat# UDI1001 NEBNext Single Cell/Low input RNA library prep kit for Illumina New England Biolabs Cat# E6420S MojoSort Mouse Ly-6G Selection Kit Biolegend Cat# 480124 MojoSort Mouse CD4 NaiveT Cell Isolation Kit Biolegend Cat# 480040 RNAscope Multiplex Fluorescent Reagent Kit v2 Advanced Cell Diagnostics Cat# 323100 BD Cytofix/CytopermTM Fixation/ Permeabilization Kit BD Cat# 554714 Cell Stimulation Cocktail (plus protein transport inhibitors) Thermo Fisher Scientific Cat# 00-4975-03 NEBuilder® HiFi DNA Assembly Master Mix New England Biolabs Cat# E2621S LipofectamineTM 3000 Transfection Reagent Thermo Fisher Scientific Cat# L3000008 CUTANATM ChIC/CUT&RUN Kit version 3 EpiCypher Cat# 14-1048 NEBNext® UltraTM II DNA Library Prep Kit for Illumina New England Biolabs Cat# E7645S Deposited data scRNAseq of CD45+ cells in skin SCC This study GEO: GSE278435 NanoString GeoMx of skin SCC This study GEO: GSE278436 Bulk RNAseq data of neutrophils in skin SCC This study GEO: GSE278430 Bulk RNAseq data or SOX2Low and SOX2High SCC cells This study GEO: GSE278429 SOX2 Cut and Run sequencing This study GEO: GSE278426 Bulk RNAseq data or ITGA6HiCD80+ and ITGA6LowCD80- SCC cells This study GEO: GSE303056 Spatial transcriptome of human HNSCC Arora et al.55 GEO: GSE208253 Spatial transcriptome of human CSCC Ji et al.56 GEO: GSE144239 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–18.e1–e11, January 12, 2026 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNAseq of neutrophils in grafted pancreatic cancer Ng et al.24 GEO: GSE243466 scRNAseq of CD11b+ cells in grafted lung cancer Gungabeesoon et al.31 GEO: GSE224399 scRNAseq of CD45+ cells in grafted colon cancer Gungabeesoon et al.31 GEO: GSE224400 scRNAseq of immune cells from lung cancer patients treated with immune checkpoint blockade Liu et al.54 GEO: GSE243013 Experimental models: cell lines Mouse skin SCC PDVC57 Bremner et al.68 N/A Mouse oral SCC MOC1 Kerafast EWL001-FP Mouse skin SCC PDV Bremner et al.68 N/A Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory 000664 Mouse: C57BL/6N-Ifngr1tm1.1Rds/J (Ifngr1flox/flox) The Jackson Laboratory 025394 Mouse: C57BL/6Ly6g(tm2621(CretdTomato)Arte); R26-LSL-tdTomato (CatchupIVM-red) Hasenberg et al.46 N/A Mouse: C57BL/6-Ly6G-CreER; R26-LSL-tdTomato Ballesteros et al.45 N/A Mouse: B6.Cg-Tg(S100A8-cre,-EGFP)1Ilw/J The Jackson Laboratory 021614 Mouse: C57BL/6-Gt(ROSA)26Sortm1(HBEGF)Awai/J (R26-LSL-DTR) The Jackson Laboratory 007900 Mouse: B6.Tg(KRT14-cre/ERT)20Efu/J (K14CreER) The Jackson Laboratory 005107 Mouse: B6.Sox2tm1.1Lan/J (Sox2flox/flox) The Jackson Laboratory 013093 Mouse: B6(Cg)-Ifnar1tm1.1Ees/J (Ifnar1flox/flox) The Jackson Laboratory 028256 Mouse: Lyz2Cre; Ptger2flox/flox; Ptger4flox/flox (Ptger2/Ptger4 dKO) Thumkeo et al.62 N/A Oligonucleotides sgSox2_F: CACCGATAAGTACACGCTTCCCGG This study N/A sgSox2_R: AAACCCGGGAAGCGTGTACTTATC This study N/A sgFads1_F: CACCGAGGCCCATTCGCTCTACTG This study N/A sgFads1_R: AAACCAGTAGAGCGAATGGGCCTC This study N/A H2-Aa qPCR forward: GGAGGTGAAGACGACATTGAGG This study N/A H2-Aa qPCR reverse: CTCAGGAAGCATCCAGACAGTC This study N/A Gbp2 qPCR forward: CTGCAC TATGTGACGGAGCTA This study N/A Gbp2 qPCR reverse: GAGTCCACACAAAGGTTGGAAA This study N/A 18S rRNA qPCR forward: CTTAGAGGGACAAGTGGCG This study N/A 18S rRNA qPCR reverse: ACGCTGAGCCAGTCAGTGTA This study N/A Ifit3 qPCR forward: GTGGACTGAGATTTCTGAACTGC This study N/A Ifit3 qPCR reverse: GCTTCCAGAGATTCCCGGTT This study N/A Cd74 qPCR forward: CTCCATGGATGGCGTGAACT This study N/A Cd74 qPCR reverse: GTGGCTCTTTAGGTGGAGCC This study N/A (Continued on next page) ll OPEN ACCESS Article e4 Cancer Cell 44, 1–18.e1–e11, January 12, 2026
Cell Stimulation:Article Title: Tumor-initiating stem cells fine-tune the plasticity of neutrophils to sculpt a protective niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER beta-mercaptoethanol GIBCO Cat# 21985023 insulin Sigma Cat# I6634 Hydrocortisone Sigma Cat# H0135 Epidermal Growth Factor (EGF), human recombinant Sigma Cat# 01-107 Recombinant Mouse GM-CSF Biolegend Cat# 576306 Recombinant Mouse IFN-α Biolegend Cat# 752802 Recombinant Mouse IFN-γ Biolegend Cat# 575302 RNAscope Probe-Mm-Gbp2-C2 Advanced Cell Diagnostics Cat# 572491-C2 Recombinant Mouse IL-2 Protein R&D Systems Cat# 402-ML-100/CF OVA 323-339 Invivogen Cat# vac-isq Aspirin Cayman Chemical Cat# 70260 Celecoxib Selleckchem Cat# S1261 DMBA Sigma Cat# D3254 TPA Sigma Cat# P8139-5MG IHC Antigen Retrieval Solution - Low pH Thermo Fisher Scientific Cat# 00-4955-58 Prolong Gold Antifade Mountant Thermo Fisher Scientific Cat# P36930 Collagenase, Type IV Gibco Cat# 17104019 DNase I Roche Cat# 4536282001 Critical commercial assays GeoMx WTA Starter Mm Nanostring Cat# 999064 EvercodeTM WT v2 ParseBiosciences Cat# ECW02030 EvercodeTM Cell Fixation v2 ParseBiosciences Cat# ECF2001 UDI Plate - WT ParseBiosciences Cat# UDI1001 NEBNext Single Cell/Low input RNA library prep kit for Illumina New England Biolabs Cat# E6420S MojoSort Mouse Ly-6G Selection Kit Biolegend Cat# 480124 MojoSort Mouse CD4 NaiveT Cell Isolation Kit Biolegend Cat# 480040 RNAscope Multiplex Fluorescent Reagent Kit v2 Advanced Cell Diagnostics Cat# 323100 BD Cytofix/CytopermTM Fixation/ Permeabilization Kit BD Cat# 554714 Cell Stimulation Cocktail (plus protein transport inhibitors) Thermo Fisher Scientific Cat# 00-4975-03 NEBuilder® HiFi DNA Assembly Master Mix New England Biolabs Cat# E2621S LipofectamineTM 3000 Transfection Reagent Thermo Fisher Scientific Cat# L3000008 CUTANATM ChIC/CUT&RUN Kit version 3 EpiCypher Cat# 14-1048 NEBNext® UltraTM II DNA Library Prep Kit for Illumina New England Biolabs Cat# E7645S Deposited data scRNAseq of CD45+ cells in skin SCC This study GEO: GSE278435 NanoString GeoMx of skin SCC This study GEO: GSE278436 Bulk RNAseq data of neutrophils in skin SCC This study GEO: GSE278430 Bulk RNAseq data or SOX2Low and SOX2High SCC cells This study GEO: GSE278429 SOX2 Cut and Run sequencing This study GEO: GSE278426 Bulk RNAseq data or ITGA6HiCD80+ and ITGA6LowCD80- SCC cells This study GEO: GSE303056 Spatial transcriptome of human HNSCC Arora et al.55 GEO: GSE208253 Spatial transcriptome of human CSCC Ji et al.56 GEO: GSE144239 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–18.e1–e11, January 12, 2026 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNAseq of neutrophils in grafted pancreatic cancer Ng et al.24 GEO: GSE243466 scRNAseq of CD11b+ cells in grafted lung cancer Gungabeesoon et al.31 GEO: GSE224399 scRNAseq of CD45+ cells in grafted colon cancer Gungabeesoon et al.31 GEO: GSE224400 scRNAseq of immune cells from lung cancer patients treated with immune checkpoint blockade Liu et al.54 GEO: GSE243013 Experimental models: cell lines Mouse skin SCC PDVC57 Bremner et al.68 N/A Mouse oral SCC MOC1 Kerafast EWL001-FP Mouse skin SCC PDV Bremner et al.68 N/A Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory 000664 Mouse: C57BL/6N-Ifngr1tm1.1Rds/J (Ifngr1flox/flox) The Jackson Laboratory 025394 Mouse: C57BL/6Ly6g(tm2621(CretdTomato)Arte); R26-LSL-tdTomato (CatchupIVM-red) Hasenberg et al.46 N/A Mouse: C57BL/6-Ly6G-CreER; R26-LSL-tdTomato Ballesteros et al.45 N/A Mouse: B6.Cg-Tg(S100A8-cre,-EGFP)1Ilw/J The Jackson Laboratory 021614 Mouse: C57BL/6-Gt(ROSA)26Sortm1(HBEGF)Awai/J (R26-LSL-DTR) The Jackson Laboratory 007900 Mouse: B6.Tg(KRT14-cre/ERT)20Efu/J (K14CreER) The Jackson Laboratory 005107 Mouse: B6.Sox2tm1.1Lan/J (Sox2flox/flox) The Jackson Laboratory 013093 Mouse: B6(Cg)-Ifnar1tm1.1Ees/J (Ifnar1flox/flox) The Jackson Laboratory 028256 Mouse: Lyz2Cre; Ptger2flox/flox; Ptger4flox/flox (Ptger2/Ptger4 dKO) Thumkeo et al.62 N/A Oligonucleotides sgSox2_F: CACCGATAAGTACACGCTTCCCGG This study N/A sgSox2_R: AAACCCGGGAAGCGTGTACTTATC This study N/A sgFads1_F: CACCGAGGCCCATTCGCTCTACTG This study N/A sgFads1_R: AAACCAGTAGAGCGAATGGGCCTC This study N/A H2-Aa qPCR forward: GGAGGTGAAGACGACATTGAGG This study N/A H2-Aa qPCR reverse: CTCAGGAAGCATCCAGACAGTC This study N/A Gbp2 qPCR forward: CTGCAC TATGTGACGGAGCTA This study N/A Gbp2 qPCR reverse: GAGTCCACACAAAGGTTGGAAA This study N/A 18S rRNA qPCR forward: CTTAGAGGGACAAGTGGCG This study N/A 18S rRNA qPCR reverse: ACGCTGAGCCAGTCAGTGTA This study N/A Ifit3 qPCR forward: GTGGACTGAGATTTCTGAACTGC This study N/A Ifit3 qPCR reverse: GCTTCCAGAGATTCCCGGTT This study N/A Cd74 qPCR forward: CTCCATGGATGGCGTGAACT This study N/A Cd74 qPCR reverse: GTGGCTCTTTAGGTGGAGCC This study N/A (Continued on next page) ll OPEN ACCESS Article e4 Cancer Cell 44, 1–18.e1–e11, January 12, 2026
Transfection:Article Title: Tumor-initiating stem cells fine-tune the plasticity of neutrophils to sculpt a protective niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER beta-mercaptoethanol GIBCO Cat# 21985023 insulin Sigma Cat# I6634 Hydrocortisone Sigma Cat# H0135 Epidermal Growth Factor (EGF), human recombinant Sigma Cat# 01-107 Recombinant Mouse GM-CSF Biolegend Cat# 576306 Recombinant Mouse IFN-α Biolegend Cat# 752802 Recombinant Mouse IFN-γ Biolegend Cat# 575302 RNAscope Probe-Mm-Gbp2-C2 Advanced Cell Diagnostics Cat# 572491-C2 Recombinant Mouse IL-2 Protein R&D Systems Cat# 402-ML-100/CF OVA 323-339 Invivogen Cat# vac-isq Aspirin Cayman Chemical Cat# 70260 Celecoxib Selleckchem Cat# S1261 DMBA Sigma Cat# D3254 TPA Sigma Cat# P8139-5MG IHC Antigen Retrieval Solution - Low pH Thermo Fisher Scientific Cat# 00-4955-58 Prolong Gold Antifade Mountant Thermo Fisher Scientific Cat# P36930 Collagenase, Type IV Gibco Cat# 17104019 DNase I Roche Cat# 4536282001 Critical commercial assays GeoMx WTA Starter Mm Nanostring Cat# 999064 EvercodeTM WT v2 ParseBiosciences Cat# ECW02030 EvercodeTM Cell Fixation v2 ParseBiosciences Cat# ECF2001 UDI Plate - WT ParseBiosciences Cat# UDI1001 NEBNext Single Cell/Low input RNA library prep kit for Illumina New England Biolabs Cat# E6420S MojoSort Mouse Ly-6G Selection Kit Biolegend Cat# 480124 MojoSort Mouse CD4 NaiveT Cell Isolation Kit Biolegend Cat# 480040 RNAscope Multiplex Fluorescent Reagent Kit v2 Advanced Cell Diagnostics Cat# 323100 BD Cytofix/CytopermTM Fixation/ Permeabilization Kit BD Cat# 554714 Cell Stimulation Cocktail (plus protein transport inhibitors) Thermo Fisher Scientific Cat# 00-4975-03 NEBuilder® HiFi DNA Assembly Master Mix New England Biolabs Cat# E2621S LipofectamineTM 3000 Transfection Reagent Thermo Fisher Scientific Cat# L3000008 CUTANATM ChIC/CUT&RUN Kit version 3 EpiCypher Cat# 14-1048 NEBNext® UltraTM II DNA Library Prep Kit for Illumina New England Biolabs Cat# E7645S Deposited data scRNAseq of CD45+ cells in skin SCC This study GEO: GSE278435 NanoString GeoMx of skin SCC This study GEO: GSE278436 Bulk RNAseq data of neutrophils in skin SCC This study GEO: GSE278430 Bulk RNAseq data or SOX2Low and SOX2High SCC cells This study GEO: GSE278429 SOX2 Cut and Run sequencing This study GEO: GSE278426 Bulk RNAseq data or ITGA6HiCD80+ and ITGA6LowCD80- SCC cells This study GEO: GSE303056 Spatial transcriptome of human HNSCC Arora et al.55 GEO: GSE208253 Spatial transcriptome of human CSCC Ji et al.56 GEO: GSE144239 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–18.e1–e11, January 12, 2026 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNAseq of neutrophils in grafted pancreatic cancer Ng et al.24 GEO: GSE243466 scRNAseq of CD11b+ cells in grafted lung cancer Gungabeesoon et al.31 GEO: GSE224399 scRNAseq of CD45+ cells in grafted colon cancer Gungabeesoon et al.31 GEO: GSE224400 scRNAseq of immune cells from lung cancer patients treated with immune checkpoint blockade Liu et al.54 GEO: GSE243013 Experimental models: cell lines Mouse skin SCC PDVC57 Bremner et al.68 N/A Mouse oral SCC MOC1 Kerafast EWL001-FP Mouse skin SCC PDV Bremner et al.68 N/A Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory 000664 Mouse: C57BL/6N-Ifngr1tm1.1Rds/J (Ifngr1flox/flox) The Jackson Laboratory 025394 Mouse: C57BL/6Ly6g(tm2621(CretdTomato)Arte); R26-LSL-tdTomato (CatchupIVM-red) Hasenberg et al.46 N/A Mouse: C57BL/6-Ly6G-CreER; R26-LSL-tdTomato Ballesteros et al.45 N/A Mouse: B6.Cg-Tg(S100A8-cre,-EGFP)1Ilw/J The Jackson Laboratory 021614 Mouse: C57BL/6-Gt(ROSA)26Sortm1(HBEGF)Awai/J (R26-LSL-DTR) The Jackson Laboratory 007900 Mouse: B6.Tg(KRT14-cre/ERT)20Efu/J (K14CreER) The Jackson Laboratory 005107 Mouse: B6.Sox2tm1.1Lan/J (Sox2flox/flox) The Jackson Laboratory 013093 Mouse: B6(Cg)-Ifnar1tm1.1Ees/J (Ifnar1flox/flox) The Jackson Laboratory 028256 Mouse: Lyz2Cre; Ptger2flox/flox; Ptger4flox/flox (Ptger2/Ptger4 dKO) Thumkeo et al.62 N/A Oligonucleotides sgSox2_F: CACCGATAAGTACACGCTTCCCGG This study N/A sgSox2_R: AAACCCGGGAAGCGTGTACTTATC This study N/A sgFads1_F: CACCGAGGCCCATTCGCTCTACTG This study N/A sgFads1_R: AAACCAGTAGAGCGAATGGGCCTC This study N/A H2-Aa qPCR forward: GGAGGTGAAGACGACATTGAGG This study N/A H2-Aa qPCR reverse: CTCAGGAAGCATCCAGACAGTC This study N/A Gbp2 qPCR forward: CTGCAC TATGTGACGGAGCTA This study N/A Gbp2 qPCR reverse: GAGTCCACACAAAGGTTGGAAA This study N/A 18S rRNA qPCR forward: CTTAGAGGGACAAGTGGCG This study N/A 18S rRNA qPCR reverse: ACGCTGAGCCAGTCAGTGTA This study N/A Ifit3 qPCR forward: GTGGACTGAGATTTCTGAACTGC This study N/A Ifit3 qPCR reverse: GCTTCCAGAGATTCCCGGTT This study N/A Cd74 qPCR forward: CTCCATGGATGGCGTGAACT This study N/A Cd74 qPCR reverse: GTGGCTCTTTAGGTGGAGCC This study N/A (Continued on next page) ll OPEN ACCESS Article e4 Cancer Cell 44, 1–18.e1–e11, January 12, 2026
RNA sequencing:Article Title: Tumor-initiating stem cells fine-tune the plasticity of neutrophils to sculpt a protective niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER beta-mercaptoethanol GIBCO Cat# 21985023 insulin Sigma Cat# I6634 Hydrocortisone Sigma Cat# H0135 Epidermal Growth Factor (EGF), human recombinant Sigma Cat# 01-107 Recombinant Mouse GM-CSF Biolegend Cat# 576306 Recombinant Mouse IFN-α Biolegend Cat# 752802 Recombinant Mouse IFN-γ Biolegend Cat# 575302 RNAscope Probe-Mm-Gbp2-C2 Advanced Cell Diagnostics Cat# 572491-C2 Recombinant Mouse IL-2 Protein R&D Systems Cat# 402-ML-100/CF OVA 323-339 Invivogen Cat# vac-isq Aspirin Cayman Chemical Cat# 70260 Celecoxib Selleckchem Cat# S1261 DMBA Sigma Cat# D3254 TPA Sigma Cat# P8139-5MG IHC Antigen Retrieval Solution - Low pH Thermo Fisher Scientific Cat# 00-4955-58 Prolong Gold Antifade Mountant Thermo Fisher Scientific Cat# P36930 Collagenase, Type IV Gibco Cat# 17104019 DNase I Roche Cat# 4536282001 Critical commercial assays GeoMx WTA Starter Mm Nanostring Cat# 999064 EvercodeTM WT v2 ParseBiosciences Cat# ECW02030 EvercodeTM Cell Fixation v2 ParseBiosciences Cat# ECF2001 UDI Plate - WT ParseBiosciences Cat# UDI1001 NEBNext Single Cell/Low input RNA library prep kit for Illumina New England Biolabs Cat# E6420S MojoSort Mouse Ly-6G Selection Kit Biolegend Cat# 480124 MojoSort Mouse CD4 NaiveT Cell Isolation Kit Biolegend Cat# 480040 RNAscope Multiplex Fluorescent Reagent Kit v2 Advanced Cell Diagnostics Cat# 323100 BD Cytofix/CytopermTM Fixation/ Permeabilization Kit BD Cat# 554714 Cell Stimulation Cocktail (plus protein transport inhibitors) Thermo Fisher Scientific Cat# 00-4975-03 NEBuilder® HiFi DNA Assembly Master Mix New England Biolabs Cat# E2621S LipofectamineTM 3000 Transfection Reagent Thermo Fisher Scientific Cat# L3000008 CUTANATM ChIC/CUT&RUN Kit version 3 EpiCypher Cat# 14-1048 NEBNext® UltraTM II DNA Library Prep Kit for Illumina New England Biolabs Cat# E7645S Deposited data scRNAseq of CD45+ cells in skin SCC This study GEO: GSE278435 NanoString GeoMx of skin SCC This study GEO: GSE278436 Bulk RNAseq data of neutrophils in skin SCC This study GEO: GSE278430 Bulk RNAseq data or SOX2Low and SOX2High SCC cells This study GEO: GSE278429 SOX2 Cut and Run sequencing This study GEO: GSE278426 Bulk RNAseq data or ITGA6HiCD80+ and ITGA6LowCD80- SCC cells This study GEO: GSE303056 Spatial transcriptome of human HNSCC Arora et al.55 GEO: GSE208253 Spatial transcriptome of human CSCC Ji et al.56 GEO: GSE144239 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–18.e1–e11, January 12, 2026 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNAseq of neutrophils in grafted pancreatic cancer Ng et al.24 GEO: GSE243466 scRNAseq of CD11b+ cells in grafted lung cancer Gungabeesoon et al.31 GEO: GSE224399 scRNAseq of CD45+ cells in grafted colon cancer Gungabeesoon et al.31 GEO: GSE224400 scRNAseq of immune cells from lung cancer patients treated with immune checkpoint blockade Liu et al.54 GEO: GSE243013 Experimental models: cell lines Mouse skin SCC PDVC57 Bremner et al.68 N/A Mouse oral SCC MOC1 Kerafast EWL001-FP Mouse skin SCC PDV Bremner et al.68 N/A Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory 000664 Mouse: C57BL/6N-Ifngr1tm1.1Rds/J (Ifngr1flox/flox) The Jackson Laboratory 025394 Mouse: C57BL/6Ly6g(tm2621(CretdTomato)Arte); R26-LSL-tdTomato (CatchupIVM-red) Hasenberg et al.46 N/A Mouse: C57BL/6-Ly6G-CreER; R26-LSL-tdTomato Ballesteros et al.45 N/A Mouse: B6.Cg-Tg(S100A8-cre,-EGFP)1Ilw/J The Jackson Laboratory 021614 Mouse: C57BL/6-Gt(ROSA)26Sortm1(HBEGF)Awai/J (R26-LSL-DTR) The Jackson Laboratory 007900 Mouse: B6.Tg(KRT14-cre/ERT)20Efu/J (K14CreER) The Jackson Laboratory 005107 Mouse: B6.Sox2tm1.1Lan/J (Sox2flox/flox) The Jackson Laboratory 013093 Mouse: B6(Cg)-Ifnar1tm1.1Ees/J (Ifnar1flox/flox) The Jackson Laboratory 028256 Mouse: Lyz2Cre; Ptger2flox/flox; Ptger4flox/flox (Ptger2/Ptger4 dKO) Thumkeo et al.62 N/A Oligonucleotides sgSox2_F: CACCGATAAGTACACGCTTCCCGG This study N/A sgSox2_R: AAACCCGGGAAGCGTGTACTTATC This study N/A sgFads1_F: CACCGAGGCCCATTCGCTCTACTG This study N/A sgFads1_R: AAACCAGTAGAGCGAATGGGCCTC This study N/A H2-Aa qPCR forward: GGAGGTGAAGACGACATTGAGG This study N/A H2-Aa qPCR reverse: CTCAGGAAGCATCCAGACAGTC This study N/A Gbp2 qPCR forward: CTGCAC TATGTGACGGAGCTA This study N/A Gbp2 qPCR reverse: GAGTCCACACAAAGGTTGGAAA This study N/A 18S rRNA qPCR forward: CTTAGAGGGACAAGTGGCG This study N/A 18S rRNA qPCR reverse: ACGCTGAGCCAGTCAGTGTA This study N/A Ifit3 qPCR forward: GTGGACTGAGATTTCTGAACTGC This study N/A Ifit3 qPCR reverse: GCTTCCAGAGATTCCCGGTT This study N/A Cd74 qPCR forward: CTCCATGGATGGCGTGAACT This study N/A Cd74 qPCR reverse: GTGGCTCTTTAGGTGGAGCC This study N/A (Continued on next page) ll OPEN ACCESS Article e4 Cancer Cell 44, 1–18.e1–e11, January 12, 2026
Sequencing:Article Title: Tumor-initiating stem cells fine-tune the plasticity of neutrophils to sculpt a protective niche.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER beta-mercaptoethanol GIBCO Cat# 21985023 insulin Sigma Cat# I6634 Hydrocortisone Sigma Cat# H0135 Epidermal Growth Factor (EGF), human recombinant Sigma Cat# 01-107 Recombinant Mouse GM-CSF Biolegend Cat# 576306 Recombinant Mouse IFN-α Biolegend Cat# 752802 Recombinant Mouse IFN-γ Biolegend Cat# 575302 RNAscope Probe-Mm-Gbp2-C2 Advanced Cell Diagnostics Cat# 572491-C2 Recombinant Mouse IL-2 Protein R&D Systems Cat# 402-ML-100/CF OVA 323-339 Invivogen Cat# vac-isq Aspirin Cayman Chemical Cat# 70260 Celecoxib Selleckchem Cat# S1261 DMBA Sigma Cat# D3254 TPA Sigma Cat# P8139-5MG IHC Antigen Retrieval Solution - Low pH Thermo Fisher Scientific Cat# 00-4955-58 Prolong Gold Antifade Mountant Thermo Fisher Scientific Cat# P36930 Collagenase, Type IV Gibco Cat# 17104019 DNase I Roche Cat# 4536282001 Critical commercial assays GeoMx WTA Starter Mm Nanostring Cat# 999064 EvercodeTM WT v2 ParseBiosciences Cat# ECW02030 EvercodeTM Cell Fixation v2 ParseBiosciences Cat# ECF2001 UDI Plate - WT ParseBiosciences Cat# UDI1001 NEBNext Single Cell/Low input RNA library prep kit for Illumina New England Biolabs Cat# E6420S MojoSort Mouse Ly-6G Selection Kit Biolegend Cat# 480124 MojoSort Mouse CD4 NaiveT Cell Isolation Kit Biolegend Cat# 480040 RNAscope Multiplex Fluorescent Reagent Kit v2 Advanced Cell Diagnostics Cat# 323100 BD Cytofix/CytopermTM Fixation/ Permeabilization Kit BD Cat# 554714 Cell Stimulation Cocktail (plus protein transport inhibitors) Thermo Fisher Scientific Cat# 00-4975-03 NEBuilder® HiFi DNA Assembly Master Mix New England Biolabs Cat# E2621S LipofectamineTM 3000 Transfection Reagent Thermo Fisher Scientific Cat# L3000008 CUTANATM ChIC/CUT&RUN Kit version 3 EpiCypher Cat# 14-1048 NEBNext® UltraTM II DNA Library Prep Kit for Illumina New England Biolabs Cat# E7645S Deposited data scRNAseq of CD45+ cells in skin SCC This study GEO: GSE278435 NanoString GeoMx of skin SCC This study GEO: GSE278436 Bulk RNAseq data of neutrophils in skin SCC This study GEO: GSE278430 Bulk RNAseq data or SOX2Low and SOX2High SCC cells This study GEO: GSE278429 SOX2 Cut and Run sequencing This study GEO: GSE278426 Bulk RNAseq data or ITGA6HiCD80+ and ITGA6LowCD80- SCC cells This study GEO: GSE303056 Spatial transcriptome of human HNSCC Arora et al.55 GEO: GSE208253 Spatial transcriptome of human CSCC Ji et al.56 GEO: GSE144239 (Continued on next page) ll OPEN ACCESSArticle Cancer Cell 44, 1–18.e1–e11, January 12, 2026 e3 .. REAGENT or RESOURCE SOURCE IDENTIFIER scRNAseq of neutrophils in grafted pancreatic cancer Ng et al.24 GEO: GSE243466 scRNAseq of CD11b+ cells in grafted lung cancer Gungabeesoon et al.31 GEO: GSE224399 scRNAseq of CD45+ cells in grafted colon cancer Gungabeesoon et al.31 GEO: GSE224400 scRNAseq of immune cells from lung cancer patients treated with immune checkpoint blockade Liu et al.54 GEO: GSE243013 Experimental models: cell lines Mouse skin SCC PDVC57 Bremner et al.68 N/A Mouse oral SCC MOC1 Kerafast EWL001-FP Mouse skin SCC PDV Bremner et al.68 N/A Experimental models: organisms/strains Mouse: C57BL/6J The Jackson Laboratory 000664 Mouse: C57BL/6N-Ifngr1tm1.1Rds/J (Ifngr1flox/flox) The Jackson Laboratory 025394 Mouse: C57BL/6Ly6g(tm2621(CretdTomato)Arte); R26-LSL-tdTomato (CatchupIVM-red) Hasenberg et al.46 N/A Mouse: C57BL/6-Ly6G-CreER; R26-LSL-tdTomato Ballesteros et al.45 N/A Mouse: B6.Cg-Tg(S100A8-cre,-EGFP)1Ilw/J The Jackson Laboratory 021614 Mouse: C57BL/6-Gt(ROSA)26Sortm1(HBEGF)Awai/J (R26-LSL-DTR) The Jackson Laboratory 007900 Mouse: B6.Tg(KRT14-cre/ERT)20Efu/J (K14CreER) The Jackson Laboratory 005107 Mouse: B6.Sox2tm1.1Lan/J (Sox2flox/flox) The Jackson Laboratory 013093 Mouse: B6(Cg)-Ifnar1tm1.1Ees/J (Ifnar1flox/flox) The Jackson Laboratory 028256 Mouse: Lyz2Cre; Ptger2flox/flox; Ptger4flox/flox (Ptger2/Ptger4 dKO) Thumkeo et al.62 N/A Oligonucleotides sgSox2_F: CACCGATAAGTACACGCTTCCCGG This study N/A sgSox2_R: AAACCCGGGAAGCGTGTACTTATC This study N/A sgFads1_F: CACCGAGGCCCATTCGCTCTACTG This study N/A sgFads1_R: AAACCAGTAGAGCGAATGGGCCTC This study N/A H2-Aa qPCR forward: GGAGGTGAAGACGACATTGAGG This study N/A H2-Aa qPCR reverse: CTCAGGAAGCATCCAGACAGTC This study N/A Gbp2 qPCR forward: CTGCAC TATGTGACGGAGCTA This study N/A Gbp2 qPCR reverse: GAGTCCACACAAAGGTTGGAAA This study N/A 18S rRNA qPCR forward: CTTAGAGGGACAAGTGGCG This study N/A 18S rRNA qPCR reverse: ACGCTGAGCCAGTCAGTGTA This study N/A Ifit3 qPCR forward: GTGGACTGAGATTTCTGAACTGC This study N/A Ifit3 qPCR reverse: GCTTCCAGAGATTCCCGGTT This study N/A Cd74 qPCR forward: CTCCATGGATGGCGTGAACT This study N/A Cd74 qPCR reverse: GTGGCTCTTTAGGTGGAGCC This study N/A (Continued on next page) ll OPEN ACCESS Article e4 Cancer Cell 44, 1–18.e1–e11, January 12, 2026
|